Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13135G12
Clone ID IST13135G12
Vector VICTR74
Project tigm

Sequence tag IST13135G12BBF1
Sequence
NNGNANCNGGCNNGGTCNNNCGNCGGNNTGGNNNNNNCCNNNTNNNNGCCTTGGTGAGGCCTTGGAGGGTAGCCTGGGGA
CTTCTGACCAGGCAGGGCTGCCCCTGACTGACCCTTCCCTGCAGCTTGCTCCTGCAACGGCCATGCGCGAANATGCCGCT
TCAACATGGAGCTCTACCGACTGTCCGGCCGCCGCAGTGGGGGCGTGTGCCTCAACTGCCGGCACAATACAGCTGGTCGT
CACTGCCACTACTGCCGGGAGGGCTTCTATCGTGATCCAGGCCGTGTCCTGAGTGACCGTCGTGCTTGCANAGGTGAGCC
TGCCACCTATACACGTTCGTGATTTACTTCCCCAGAANCCCAGCTACAGTTCTGAGCTTC
Sequence Type genomic DNA
Unitrap ID UNI33110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24344678..24345009 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079662 (Ntn2l) NM_010947 netrin 2-like (chicken) Gene [Source:MGI Symbol;Acc:MGI:1341188]

 
Come back to gene ENSMUSG00000079662


For any suggestions or comments, please send an email to unitrap@crg.es