Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12315H1
Clone ID IST12315H1
Vector VICTR76
Project tigm

Sequence tag IST12315H1HMF1
Sequence
AGACTAGTACTGGGGGAGGGGGTAGCAATACTATCGAGCGAAACGCTCCTCTGTCTTGGCCGAAAGAAGACAAATATGTG
GCAGTGGTAAATGGAAAGATAGGGGCTGGAGCAATGGCTTAGTACATAAGAGCTGCTCGACTAGAGGACATTGTTCCGTT
TCTAGCACCCATATGGCAGCTCACAATCATTTGTAACTCCAGTTCCAGGCAACTCANCATCCTCTTCTGACCTCCAGGAG
TATCAGGCACACACGTGGTCCACACACATCCCTAGAGACAAAACACCCACACACTTAACATAAAAATAAATCCACCTTTT
AAACTGGAATAGTGGTACGTCNGAGCCTGCACTTGGGGGGGGGGGNNNAA
Sequence Type genomic DNA
Unitrap ID UNI12836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7586061..7586425 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es