Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13067A7
Clone ID IST13067A7
Vector VICTR76
Project tigm

Sequence tag IST13067A7HMR1
Sequence
GGTGGAATTCGTGCCTGGAGGAATACCATTTCCTGTCACATGCATCCACTCCTGACTTGGACTCTTGAGCTGTGATGCAT
GAGAGAACTCTGGGTCTTTCCAATTCTCGGGTACCTGGATATGTTAAAGAAAAGAATAAATAGCTACCCACCTCCTGCCA
AAGTCTTCCTGGCTCCTTGGGCAGATATACTACTTAATTGTGGAAACATTTATTTTTGTGGTATTATAGAAGATGTTC
Sequence Type genomic DNA
Unitrap ID UNI10676

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88791199..88791435 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]


Sequence tag IST13067A7HMF1
Sequence
CACCAATCCCAAGGCCTATGCATCCTGGGCCANNNCCNANNGGCTTGTCCCCTGATTGCTACCGTGTGTCCCCCAGAGTT
TGGTTCCTACCTATGGTGTCCACAATGAGATCCAGCTGTCCGTTGTACACGGTCACATTGACCCCAGCTGCCAGCAACTT
ATCCACAACGTCGATGGCAGGCTTCATGAAGTCCCCTTCCATGCTTAGGAAGACATAANATGCCTGGGCTACAGAAGGTG
AAGGANAAAGAGGTAACACGTTGGAATTAANAAATCTCTTTCTGCCCAAGCATTCTAAACTATGGTTCCTAAAAGTCCCT
ANGTGTCAGGGGTGTGTGTGTGTGTGTGTGTGTATGTGTGTGTGTNTNTGTGTGANTTCNNNGGCTTNNAACTGANNCNN
NCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es