Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W030E07
Clone ID W030E07
Vector pT1betageo
Project ggtc

Sequence tag W030E07
Sequence
AGGGAGGAACTAGACCTTCCTNNNAGTGCGAACCAACCGGCAAACCAGACTGAATGCTCGGATTGGGAAAATGAAACGGA
GGAAGCAAGATGAAGGCCAGGTATGTCCCCTGTGCAGCCGCCCCCTGGCAGGATCGGAGCAGGAGATGAGTAGGCATGTG
GAGCACTGCCTCGCTAAGAGGGAAGGCTCCTGCATGGCTGAAGATGATGCTGTGGACATCGAGCATGCGGACGGCAACCA
CTTTGGGGGGTGTGGGTTGTGTGGGCAGAAGCGGATACGGGCCACCACACTCCTGGAAGGTGGCTTCCGAG
Sequence Type mRNA
Unitrap ID UNI12384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116957984..116961675 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es