Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12516E1
Clone ID IST12516E1
Vector VICTR76
Project tigm

Sequence tag IST12516E1HMF1
Sequence
GCATCTGAAGAAGGAAGAGAGTTCTGGTTTTCCCGATCAAACACTAGACAGAGACTCTTGCGACTTTTTCTCGGGAGAGT
TGANATTGTCNCAGGAAGGAAAGANAGNNNATCN
Sequence Type genomic DNA
Unitrap ID UNI9935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37125236..37125342 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024459 (D130003B22Rik) NP_001108547 histocompatibility 2, M region locus 6, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:95918]


Sequence tag IST12516E1BBF1
Sequence
CCTTTAAGTGGCACCACCTGTATTTGGTGATTTGCATGGTTGTAAATTAATTTTTTTCTCTTCCCTTTCTTCCTCCAAAC
AACTCAAGAGTTTGCTGGCACCACCATAATAAATTCCATAGGTTGGGTAGCTCAACAGAAATTTATTGTCCAACAATTCA
GTTCATTAGCTGTGATGGTTAATATTAGTTGTCAGCTTAATGGGATCTAGAGGACAAGCCTCTGGGTATGCCCTTAGATC
AGGCTAGCCTCTGGGTTATGTGTGTGAGGGATCATCTAGATCATCTAGCTTAATGGGATCTAGAGGACAAGCCTCTGGGT
ATGCCCTTAGATCAGGCTAGCCTCTAGGTTGTGTGTGAGGGATCATCTAGATGGGGTTGAGGTGGGATGATCCATACTGA
GTGTGGACATAGCACCATCTTGTAGTCTAGGGTCCCAGACTNAATAAGAAGGAGAAAGTCTCCGCTGCTTCCTCCTACAG
ATACNATGTGACCAGCTACCTCAAANCCCTGTCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33438563..33439075 507
 
EST/CDNA Est Name
  AW212244.1

 
Come back to gene AW212244.1


For any suggestions or comments, please send an email to unitrap@crg.es