Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0606
Clone ID AY0606
Vector pGT0lxr
Project sanger

Sequence tag AY0606
Sequence
GGGGTTTTTTTAAGGGGTTTTTTTTTTTTTTTGGAAAATTGGGCCGAGGAGGAAGTGAAGGCTGTAACATCCCCCAGAAC
ATTGAGAGACTAAATGGCCAGGGGGTATGCCAGATTGAGTGTGGAGCTCAGTTTTCCTTGGCACTCACCAAGTCAGGAGT
GGTGTGGACGTGGGGGAAGGGCGACTACTTCAGACTGGGCCATGGCTCTGATGTCCATGTGCGCAAGCCACAGGTGGTGG
AAGGACTGAGAGGGAAAAAGATTGTGCATGTGGCAGTTGGAGCCCTGCATTGCCTAGCAGTCACAGACTCAGGGCAG
Sequence Type mRNA
Unitrap ID UNI1887

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 63440191..63441349 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030451 (Herc2) NM_010418 hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 2 Gene [Source:MGI Symbol;Acc:MGI:103234]

 
Come back to gene ENSMUSG00000030451


For any suggestions or comments, please send an email to unitrap@crg.es