Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M064B08
Clone ID M064B08
Vector ROSAbetageo
Project ggtc

Sequence tag M064B08
Sequence
AACCCAGCCCCTTGTTCTAAAATGGGACCCTTCTAAGCACACCATTCCCATCATGGGAATCACTGTTGGCCTGCTTCTCT
TTGGAGTTGTGTTTACTGGAGCTGTGCTCGCAATAGTCATTAGTAATAGCACAG
Sequence Type mRNA
Unitrap ID UNI5839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37124361..37124625 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024459 (D130003B22Rik) NP_001108547 histocompatibility 2, M region locus 6, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:95918]

 
Come back to gene ENSMUSG00000024459


For any suggestions or comments, please send an email to unitrap@crg.es