Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14193G2
Clone ID IST14193G2
Vector VICTR74
Project tigm

Sequence tag IST14193G2HMR1
Sequence
NGGTAATTTAATTTAACTTGATTTTCTGTTTTGCTTCTATTCATCTGTATTTTATTTTATTTTTGTGTGTATATGTGTGT
GTGGGANTGTATGTGTNTNNNCN
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62260809..62260903 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST14193G2BBF1
Sequence
CCTAGACTCCAGAAAGCATGACACTCAAAGAAAAACTTTCATAAGGACATAAGTAATTGGTGGACTTACAGTAAGCATTC
AAAAAAGAATTCATGAAGCCAGGCGTGGTGGCGCACGCCTTTACTCCCANCACTCGGGAGGCANAGGCAGGAGGATTTCT
GAGTTCAAGTCCAGCCTGGTCTACANAGTGAGTTCCANGACANCCAAGGCTACNCAGANAAACCCTGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62260903..62261131 215
 
EST/CDNA Est Name
  BY311284.1 - BE647957.1 - BP753711.1

 
Come back to gene BY311284.1 - BE647957.1 - BP753711.1


For any suggestions or comments, please send an email to unitrap@crg.es