Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14596E8
Clone ID IST14596E8
Vector VICTR74
Project tigm

Sequence tag IST14596E8HMR1
Sequence
AAATTCATCCATTTCTTTGTATTTTCCANTTTGGTGGATTACAGCTTTTTAAAACGTGTTTTTTTTTTTTNTTTN
Sequence Type genomic DNA
Unitrap ID UNI3444

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20257312..20257385 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063108 (Zfp26) NM_011753 zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]


Sequence tag IST14596E8HMF2
Sequence
CTGTGACTGGCACCATGAGCCGGAGCTGCGCGAGGGATGAGGGGCATCGGGGTCTTTAGCAATGTCTGCACCTTACAGCT
GGGCTGCCCCCCGGTCCCCCAGCCCCGGTTCTCCCCACCCAGTCTCACCAGCAGAGCATTCAGCCCACTGATGTCTGAGT
AAGGCAATGGGGCCCGGTAAGTCTCCGTCGTCTTCCACCAGAGCGGCAGTCCCAGAAGGATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78142276..78142501 226
NO GENE  


Sequence tag IST14596E8BBF3
Sequence
TTTCTTCATATTATGACATACAGAAGTTAAACCAAGATCAAATAAGCAATTTAAACAAACCAAGATCCAAGAAGTTGTAA
CTAAAAGACTCCCAACCACAAGAGCCCAGGACCAGATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20257383..20257504 122
NO GENE  

 
Come back to gene ENSMUSG00000063108


For any suggestions or comments, please send an email to unitrap@crg.es