Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10872E11
Clone ID IST10872E11
Vector VICTR76
Project tigm

Sequence tag IST10872E11HMR1
Sequence
GTGTCTACTTCCCTTTTTAGGTCTAGTATGGTTTTGTTCATTTCCATCACCTGTTTGTATGTTTTTTCCTCTTTTTCTGT
AAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTAGCGGTGTTCTCCTGTATTT
CTTTAAGTGATTTATTAAAGCCCTTCTTGATGTCCTCTACCATCATCATGAGATATGCTTTTAAATCTAGGTCTAGGTTT
TCGGGTGTGTTGGGGTGCCCTGGACTGGGCCAAGTGGGAGTGCTGGGTTCTGATGATGGTGAGTGGTCTTGGTTCCTGTT
ANTAGGATTCCTACGTTTACCTTTAGCCNTCTGGTAANNNNNGGAGTTANTANTTATANTTC
Sequence Type genomic DNA
Unitrap ID UNI33123 UNI33124

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 14341341..14341721 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27225823..27226203 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 58112537..58112917 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038048 (Cntnap5c) NM_001081653 contactin associated protein-like 5C Gene [Source:MGI Symbol;Acc:MGI:3646013]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 53193185..53193565 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 92644868..92645248 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 59294389..59294769 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 25409334..25409714 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036611 (Eepd1) NM_026189 endonuclease/exonuclease/phosphatase family domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914734]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32248048..32248428 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 19043779..19044159 353
 
EST/CDNA Est Name
  BY305468.1 - CJ223283.1 - BY559399.1 - CN671380.1 - BY566802.1 - CA886748.1 - AI645701.1 - AI426759.1 - AI561760.1 - CJ168023.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 15556462..15556842 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 60049349..60049729 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9331063..9331443 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 20287049..20287429 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 143509060..143509440 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15485281..15485661 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16119213..16119593 353
 
EST/CDNA Est Name
  BY559399.1 - BY566802.1 - CA886748.1 - AI645701.1 - AI426759.1 - AI561760.1 - CJ168023.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14471623..14472003 353
 
EST/CDNA Est Name
  BY559399.1 - BY566802.1 - CA886748.1 - AI645701.1 - AI426759.1 - AI561760.1 - CJ168023.1

 
Come back to gene BY559399.1 - BY566802.1 - CA886748.1 - AI645701.1 - AI426759.1 - AI561760.1 - CJ168023.1


For any suggestions or comments, please send an email to unitrap@crg.es