Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M014F04
Clone ID M014F04
Vector U3betageo
Project ggtc

Sequence tag M014F04
Sequence
GGGAATCCGTGGACATCCGGACAGACACAGTTTTGGCAGGACCGCACAGCCTAGCG
Sequence Type mRNA
Unitrap ID UNI12386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24857121..24857176 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044533 (Rps2) NM_008503 ribosomal protein S2 Gene [Source:MGI Symbol;Acc:MGI:105110]

 
Come back to gene ENSMUSG00000044533


For any suggestions or comments, please send an email to unitrap@crg.es