Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M016F08
Clone ID M016F08
Vector U3betageo
Project ggtc

Sequence tag M016F08
Sequence
TGATAGCAGCCTCCGGCGCCGCGTCTTCCTTTGCAGCCACCGGCCCTCGTCTGCTTCCGGCCCCGTTGCATGGCCCGGCC
CCGCGATTCCCCCGGGAGGAAGCCGTGGGCCGTGGCTCCCTTGGGGTGAGGGTCACTGTCCCGTCCTGGGTAGGAACTGT
GTCCGAAAAGAGCAGGCTGGAACGGGCTCCCAG
Sequence Type mRNA
Unitrap ID UNI8531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133228166..133228356 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]

 
Come back to gene ENSMUSG00000043257


For any suggestions or comments, please send an email to unitrap@crg.es