Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M017A07
Clone ID M017A07
Vector U3betageo
Project ggtc

Sequence tag M017A07
Sequence
TGGGGAAGTCCGGCCGGGGAATTCATCTGATCATTGCGTTTCTGTGGAATGTGTTTTGAGCGCCTCTACTAATTGATGTA
AGGGGACCTCACAAACTCAAAACGCCAGAC
Sequence Type mRNA
Unitrap ID UNI12387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177056962..177057052 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078869 (OTTMUSG00000016577) predicted gene, OTTMUSG00000016577 Gene [Source:MGI Symbol;Acc:MGI:3649811]

 
Come back to gene ENSMUSG00000078869


For any suggestions or comments, please send an email to unitrap@crg.es