Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0487
Clone ID AY0487
Vector pGT0lxr
Project sanger

Sequence tag AY0487
Sequence
TAGGGAAACGAGACATGCCTTGTCTGCCTGGTGCCGAGGGGCAAGGACACAGAAGTGGGTTCGAAATGTCAGCTACTTCC
GGCTAGATGGTAGCACCCCTGCCTNTGAGAGGGAGCGGCTCATTAATCAGTTCAATGATCCCAGCAACCTCACCACCTGG
CTGTTCCTTCTCTCCACAAGGGCCGGATGCTTGGGGGTGAATCTGATTGGTGCCAATCGAGTGGTGGTATTCGATGCTTC
CTGGAACCCTTGCCATGATGCCCAGGCAGTATGTCGGGTATACCGTTATGGCCAGAAAAAGCCCTGTCACATCTATCGAC
TCGTGGCTGATTATACTCTTGAGAAGAAGATATATGACCGGCAGATTTCCAAGCAGGGCATGTCAGATCGGGTAGTGGAT
GATCTAAATCCAATGCTGAACTTCACCCGGAAGGAAGTGGAAAACCTGCTGCACTTTGTTGAGAAGGAGCCAGCTCCCCA
AACATCTTTGGATATAAAGGGGATCAAGGAGTCAGTCTTGCAACTTGCCTGCCTGAAGTACCCTCACTTCATCACCAAG
Sequence Type mRNA
Unitrap ID UNI1892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106605823..106610626 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es