Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M021F04
Clone ID M021F04
Vector U3betageo
Project ggtc

Sequence tag M021F04
Sequence
TTTTATCAGGGGGGCGCGGAGGGTGTTTTCTCATCTTTTGTGGTGGCGCGGCTGATAACAACAGAGAACATGGCGGCCCA
GAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGATGATATGAATTTAAAGGA
GTCCCTTCTTCGAGGCATCTATGCATATGGTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATCCCTTGTATTA
AAGGTAAAACTCTATTGCCGTTAGGATAAGTGCTCTGCACATACATGGACCGGAAAAGGGAAAGTGACCTTTGGGGAAGT
ACTAGCACCTGATTGTATTCC
Sequence Type mRNA
Unitrap ID UNI246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23108655..23109022 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022884 (Eif4a2) NM_013506 eukaryotic translation initiation factor 4B Gene [Source:MGI (curated);Acc:Eif4a2-002]

 
Come back to gene ENSMUSG00000022884


For any suggestions or comments, please send an email to unitrap@crg.es