Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11295D4
Clone ID IST11295D4
Vector VICTR76
Project tigm

Sequence tag IST11295D4HMF1
Sequence
GTTTTAACGGTTANAGTTATTTTTATAGTCANCANAAATAATGTTAGCCTCTCTTCATTATAAATTTTANGCATTTTTAA
AATATGTAGCTAGCAGGTGCTTCGGGTACCCTCTGCCTCTGCATCCTTGGTTTCATGTCAGTCCNAACAACACCATTCGT
GGA
Sequence Type genomic DNA
Unitrap ID UNI4925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71176811..71176972 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST11295D4BBF1
Sequence
GTTTTAACGGTTAGAGTTATTTTTATAGTCAGCANAAATAATGTTAGCCTCTCTTCATTATAAATTTTAGGCATTTTTAA
AATATGTAGCTAGCAGGTGCTTCGGGTACCCTCTGCCTCTGCATCCTTGGTTTCATGTCAGTCCAAACAACACCATTCNT
GGCCNGCCTTTGTTTCATTCGGTTCACCCCACATACTGATTCTCTCTCTCTCCCCCTCTTCATCTCTCTCTCCTTGGAGC
TGGATATGGAGTTNACGGTCTCCCATGTGCTTANNTACACCTNACCCANCTGCTTGCTTTTGAGGAATGAGTGGTTGGTC
CTGGTATCTTGCAACTCCATCTGTTGNNATGCTCCTAACATTTGTTNAATGGTGACTACATTTTCTGGGGCTGGNNANAC
CGTTCANTTNANNNNTTCANNANANCACTGANGAAGTNNGAAGTGGGTGTCGGTTGGTACCTGCGTGTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es