Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14166E1
Clone ID IST14166E1
Vector VICTR74
Project tigm

Sequence tag IST14166E1HMR1
Sequence
ACACGTTTCTTTACCNNCTNACCTCCCGGTGGNGGGTCGGTGNNCNNTTTCCTANGTGCTGGGGCTATAGGTGTGANTAA
CTGTACTAGGTCTTGTTTATAACCATTGACTGATGTTTGTGGTATAAAGGGTCAAACCCAGGGTCTGCACTTGCTAAGCA
C
Sequence Type genomic DNA
Unitrap ID UNI25340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105047356..105047468 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]

 
Come back to gene ENSMUSG00000020694


For any suggestions or comments, please send an email to unitrap@crg.es