Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14813C1
Clone ID IST14813C1
Vector VICTR76
Project tigm

Sequence tag IST14813C1HMR1
Sequence
CAAGGAAAGGGGTTGTAATGCAGAGGAATGATAATGAGCAGGGTTTGGTTAGAGGCAGAGTTGAAGGTAGGAGTGGCAGG
AAATGAGCTGGGAGATAGGACTAGGCTGCGGTTC
Sequence Type genomic DNA
Unitrap ID UNI23296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36981272..36981384 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024457 (Trim26) NM_001025599 tripartite motif-containing 26 Gene [Source:MGI Symbol;Acc:MGI:1337056]


Sequence tag IST14813C1BBF1
Sequence
GTAGCTCATTGACAGAGCCAGGGCTTATGCACAAAGCTTTGGGTGAGATCCACAGAGCCCCCTACTCCCCTATACATTTC
TGGAATCTGCTAACCCTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62317827..62317929 103
NO GENE  

 
Come back to gene ENSMUSG00000024457


For any suggestions or comments, please send an email to unitrap@crg.es