Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M028D02
Clone ID M028D02
Vector U3betageo
Project ggtc

Sequence tag M028D02
Sequence
CGAGTCCGGTCTCAAAATGGAGGGCCATGATCCAAAGGAACCAGAGCAGCTGAGGAAGCTATTTATTGGTGGTCTGAGCT
TTGAAACCACAGATGATAGCTTAAGAGAACATTTTGAGAAATGGGGCACACTTACAGACTGTGTGGTAATGAGAGATCCC
CAAACAAAACGTTCCAGAGGCTTTGGTTTTGTGAC
Sequence Type mRNA
Unitrap ID UNI5037 UNI5039 UNI11424 UNI12390 UNI12391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9564641..9564835 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067880 (AC103620.12)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 122517144..122517338 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066538 (AC164315.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54285372..54285566 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069014 (AC121785.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 111480853..111481047 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060887 (AL671895.9)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114538730..114538924 195
 
EST/CDNA Est Name
  BB421125.1 - AI449967.1 - CA553980.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77702062..77702256 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067669 (AL844863.7)  

 
Come back to gene ENSMUSG00000067669


For any suggestions or comments, please send an email to unitrap@crg.es