Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13805G5
Clone ID IST13805G5
Vector VICTR74
Project tigm

Sequence tag IST13805G5BBF1
Sequence
GGTGTAGGCCTTTTCTTCCCCCCCCTTCCCCTCGCCCCCCCCTTTTTANTTCCAAACATCTCTCTACTCCCACAAACACT
TTTTGTTTCGTTTTGTTGTTTTGTTTTTGGANACNNATCTG
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155062549..155062668 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]


Sequence tag IST13805G5HMF1
Sequence
GGTGTAGGCCTTTTCTTCCCCCCCCTTCCCCTNGCCCCCCCNTTTTTANTTCCAAACATCTCTNTACTCCCACAAANNNT
TTTTGTTTCGTTTTGTTGTTTTGTTTTTGGANACNNATCTCACTGTATAGCCCAGCTACCTTGCAACTTGCTATGTAAAC
AAAGCTAACCTCAAATTCCTANANAGCCACTTGCCTTTCCCTCCTAGGTTATGGGAGTGTTGAAGGTTAAAGGTGTGTAC
CACCATATCTGACCANTAAATGTAACATAAAANAATTTTTTAAAAAGATTTATTTATTTGTTTGTTTGTTTATTTATTTA
NTNATTTANTACNNGTAAGTACACNGNAGCTGANTTCAGACACACCNNAANANGGCATCNNATCTCATTACGGGTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es