Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14807H6
Clone ID IST14807H6
Vector VICTR76
Project tigm

Sequence tag IST14807H6HMF1
Sequence
GAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGC
Sequence Type genomic DNA
Unitrap ID UNI9937 UNI29612 UNI30954 UNI30955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 77846..77883 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053211 (Zfy1) NM_009570 zinc finger protein 1, Y linked Gene [Source:MGI Symbol;Acc:MGI:99212]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47061427..47061464 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 17177257..17177294 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15676364..15676401 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30117965..30118002 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 54159063..54159100 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21321544..21321581 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 28224210..28224247 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59814580..59814617 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22678666..22678703 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 34659124..34659161 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 50894318..50894355 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23257266..23257303 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031478 (Nek3) NM_011848 NIMA (never in mitosis gene a)-related expressed kinase 3 Gene [Source:MGI (curated);Acc:Nek3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35009762..35009799 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20087866..20087903 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9139445..9139482 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 58879598..58879635 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050812 (AI314180) NM_172381 Proteasome-associated protein ECM29 homolog (Ecm29) [Source:UniProtKB/Swiss-Prot;Acc:Q6PDI5]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 73313939..73313976 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12848211..12848248 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24757806..24757843 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036893 (Ehmt1) NP_001012536 euchromatic histone methyltransferase 1 Gene [Source:MGI (curated);Acc:Ehmt1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10228969..10229006 38
NO GENE  

 
Come back to gene ENSMUSG00000036893


For any suggestions or comments, please send an email to unitrap@crg.es