Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10061E1
Clone ID IST10061E1
Vector VICTR75
Project tigm

Sequence tag IST10061E1HMR1
Sequence
NNGGNNNCCGGGGAGGTGGGGTGAGCACTGTTGGCTCAGAACGGACTGTAGGCAGCAGTATTTATGGTGTAGCTTGCTGG
GAGGGTGGGAGAGAGGAACACCTGGACGGTACTGCACTAGGATGAGGGTAGGACTTTACCCCATTGTCTGCTTGGCCTCT
TCACCGCTCTCCCCGTTTTCACGAAAGCTAGGAAGTCTTGATGAGAAAGATTTTTCTGGAGGTAGAAACACATCCAGGGC
CTTGCATGTTGTCTTGGGGTTGGAGTCTGGCTGGCTTTGGGGACCCTAGGTGGGGAGGCANGGCTGTNANGANTCTTGAN
TGCCTTCCANTTNTGN
Sequence Type genomic DNA
Unitrap ID UNI17470

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26068305..26068632 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

 
Come back to gene ENSMUSG00000005442


For any suggestions or comments, please send an email to unitrap@crg.es