Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0194
Clone ID GC0194
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0194
Sequence
CTGTGTTTTCCAGCAGTGTCTTGGGTGTGTTGGGCCTGTTAATGA
Sequence Type mRNA
Unitrap ID UNI4

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87578276..87578320 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]

 
Come back to gene ENSMUSG00000031691


For any suggestions or comments, please send an email to unitrap@crg.es