Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0450
Clone ID AY0450
Vector pGT0lxr
Project sanger

Sequence tag AY0450
Sequence
AGAGGAACTCCAAAACCAAGAGGAAAAGTGATTCAGAAAATAGGGAGAAGAAAAATGAAAACTCAAAAGTTTTTGAATTG
TCGAGGGCGGGGGGCAGTCCAAAGGCAGGCGGATAATGTGAGTCAGGAGTTAGGGTGAGGATAAGTGAGAGATCAAGAGC
CTAGGAATGGGGCTGTGGCAAAAGAAAGAAAACCCCAGCAAGAAAGACATCCTCCCTCCAAAGATGTTTTCCTTCTAGAT
CTGGACGACTTTAACCCAGTATCCACCCCAGTTGCCCTTCCTACACCAGCCCTTTCTCCAAGCTTGATAGCTGATCTTGA
AGGTCTAAACTTGTCAACTTCTTCATCAGTCATCAAC
Sequence Type mRNA
Unitrap ID UNI1896

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95249802..95271979 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021686 (Ap3b1) NM_009680 adaptor-related protein complex 3, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1333879]

 
Come back to gene ENSMUSG00000021686


For any suggestions or comments, please send an email to unitrap@crg.es