Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10055B11
Clone ID IST10055B11
Vector VICTR75
Project tigm

Sequence tag IST10055B11BBR1
Sequence
GGTGGAGTGGAGTCTCCACTTGTTACTGGGTTCCTACTGATGGTACATAAGCCTCTGGGCAAACTCGCTGCCTTGTACTC
TCAGGGACGTGGGACTCTAGCGGGAATTGTAGGAACTGTATGTAGATACCCAGGTAGTGAGGGAAGAAAGACTACAGACT
AAAGACGGTGTGGGCAAAGCAAAGAATTGTGGAAGACCGTTGCATACTGTGAAAATCTGTTCTTGCATCCTAAGATTGAT
TTGAAAAGTTGTGGATGGCAGAAGACCTTAGAGAAGTAGGCGGGATCTTAGTGACAGTGTATCTGAATGCCCCTTCCCCT
TGTAGATTTACATGGATCCGT
Sequence Type genomic DNA
Unitrap ID UNI14321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33412652..33412991 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040594 (Ranbp17) NM_023146 RAN binding protein 17 Gene [Source:MGI (curated);Acc:Ranbp17-001]

 
Come back to gene ENSMUSG00000040594


For any suggestions or comments, please send an email to unitrap@crg.es