Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14724A5
Clone ID IST14724A5
Vector VICTR76
Project tigm

Sequence tag IST14724A5HMF1
Sequence
TTNNTCCCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGANTTT
Sequence Type genomic DNA
Unitrap ID UNI19402 UNI28368 UNI33139 UNI33140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5896087..5896128 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 31911692..31911733 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29131344..29131385 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3816590..3816631 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 59004155..59004196 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107621612..107621653 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12170040..12170081 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 49007703..49007744 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14295940..14295981 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053914 (Jmjd2d) NM_173433 jumonji domain containing 2D Gene [Source:MGI (curated);Acc:Jmjd2d-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 78396386..78396427 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 15335742..15335783 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34713184..34713225 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 37525022..37525063 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 78134186..78134227 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28174966..28175007 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41086750..41086791 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 73445025..73445066 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027792 (Bche) NM_009738 butyrylcholinesterase Gene [Source:MGI (curated);Acc:Bche-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12940266..12940307 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3820903..3820944 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 18345457..18345498 40
NO GENE  


Sequence tag IST14724A5HMR1
Sequence
GCATGTTCCAATGAAAATTTATTAGGGGTGTAACCTATGTTTAAGAATGAACTAGGTAGCCAGGTGTGGTGGTGCACGCC
TTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAAAGTGAGTTCTAGG
ACAGCCAAGGCTACACANANAAACCCTGTTTTGAAAACAAAACAAAACAAAACAAAACAAAACAGCTAAAAGAATGAACT
AAGTATATATCAAAATGCTCTGTCCTGGGCATTGAACATTTCAGTAAACAGTTATTAAGGCACTGACACAGATGGATGTC
ATGTTCCATGCCCTGCAAACACGCANAGAAGAGACAGTCTTAAGCTTCANANANCTTGCTTGCTCTGGGGTANGTGGTAT
GGGATGTGGCAGGTGNNGTGNACAGGANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10860234..10860660 407
NO GENE  


Sequence tag IST14724A5BBF2
Sequence
ATGCCNNANTGCTTTNATGTGGTCANCCCNTCNNTAGGCTTTCCNTGAAACCCANNCNNNGCANNGTTTTGCAAGGAAAC
TGGATTANNGTANTTATATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027792


For any suggestions or comments, please send an email to unitrap@crg.es