Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10949B8
Clone ID IST10949B8
Vector VICTR76
Project tigm

Sequence tag IST10949B8HMR1
Sequence
TTTNNGTTGGGTAGAGATACTTACNACCTATATTCACATATAGATTGCCTTACAGCTGAGAAACATTAATGTAATAAACA
TACGTGTGACTCGCTTCCGTCTTTGCTGTTCAGCACGTGCACTAGGTTACCATGCAGGTGGAAAGGGACTGTCGAGCTCT
CCTGGCTTTGAAGAAGGAATGGACTCAGTAAGTTGTGAGGCTGCAAGTCTTTGTTATGTAATTG
Sequence Type genomic DNA
Unitrap ID UNI16102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95584953..95585176 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042043 (Tbca) NM_009321 tubulin cofactor a Gene [Source:MGI Symbol;Acc:MGI:107549]


Sequence tag IST10949B8BBF1
Sequence
AAACAAATTAAGAAAAAATAGGCCCCAGGGGCTGGAGACTAAAATGGAGTTTTAAATATATACTAAATTTACCCTTAAAG
TTTAATAACTTATGAAGGTCTCATATGAGTTTGTAAGTTGGTTTCTCATTTTAAATTTGTTTCCATGTTTTGTTTTAAAA
TGGAGTCTCTTTGTGTGGTCCTGCCTGTCTCCAAACTCCTTGGTTCAAGGGAATCTCTTGCTTTAGCCTCGGGAGTAAGG
TAGATAGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95584705..95584955 251
NO GENE  

 
Come back to gene ENSMUSG00000042043


For any suggestions or comments, please send an email to unitrap@crg.es