Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10920F10
Clone ID IST10920F10
Vector VICTR76
Project tigm

Sequence tag IST10920F10HMR1
Sequence
NTATAGCTTGGGGCCCCAGGCGCAGTGGCTTGAGTTTAGCGTGATGAGGATTGCTGGCCTCCCCCAGACATGGCCTTGGG
GTGTTTCTGTCCCAAGGTGTTGAAACTGCCCATTTGTGATGGAACTATCCCAACTTCAGGGCAGTGTTTTTTGTTTGTTT
GNTNGNTC
Sequence Type genomic DNA
Unitrap ID UNI33141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180191829..180191988 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038963 (Slco4a1) NM_148933 solute carrier organic anion transporter family, member 4a1 Gene [Source:MGI (curated);Acc:Slco4a1-001]

 
Come back to gene ENSMUSG00000038963


For any suggestions or comments, please send an email to unitrap@crg.es