Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15042A6
Clone ID IST15042A6
Vector VICTR78
Project tigm

Sequence tag IST15042A6HMR1
Sequence
CTGTCACTCCAAAGTANTTAACGTGTCATTCCCAGAGCGCGATCNGANAACTCCACTCCTCATTTCTCCTCTCTCCCCTC
TGCCTTGATCTAGCAAGATTCCAAACCTGGGGCACCGGCTTCTGGCTTCCCCAGTCAGTGATTTGCAGCTCCCAGGGCTG
TCTTACTAAAGCGGCACCTCTGCTCTTTCCATGTTC
Sequence Type genomic DNA
Unitrap ID UNI19515

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127648550..127648744 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051346 (Spryd4) NM_025716 SPRY domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1913951]


Sequence tag IST15042A6BBF1
Sequence
GGGACCATGTATTTATTATTTAATCCTACTTTTATGCCACTTCCATCAAAATGTGGTCGACTTCCCGAACTTCCTCAACC
TTAAAAAAAAGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66473358..66473457 100
NO GENE  


Sequence tag IST15042A6HMF1
Sequence
GGGACCATGTATTTATTATTTAATCCTACTTTTATGCCACTTCCATCAAAATGTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66473400..66473457 58
NO GENE  

 
Come back to gene ENSMUSG00000051346


For any suggestions or comments, please send an email to unitrap@crg.es