Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14332E7
Clone ID IST14332E7
Vector VICTR74
Project tigm

Sequence tag IST14332E7BBF1
Sequence
GTTGTGAGCCNCCATGTGGTTGCTGGGATTTGAACTCATGACCTCTGGAAGAGCAGTCAGTGCCCTTAACTGCTGAGCGA
TGCATCTCTCCAGCCTGATGGTTAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97856986..97857095 108
NO GENE  


Sequence tag IST14332E7HMR1
Sequence
NATCTGTAATGGGGTCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACANTGTACTCATAAATGAAATAAATAAATC
TTTAAAAATAAACCCTTAACCATCCACCTACAAACTCANAGGTGGGCCTTACCCAACTGTAAGCAAATCTTTTACAGGGA
CTAGAAAGGGCTTGCTGAGCACTGCCGAGGACCACGTANTTTTGGGTANTANTANCTTTTCAGTTATTTCATTATTGGCA
CACTCAACTTCTTGGCTCTCANNNGAAGGTGAGTGTTTGGGTN
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857097..97857377 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


Sequence tag IST14332E7HMF1
Sequence
GTTGTGAGCCNCCATGTGGTTGCTGGGATTTGAACTCATGACCTCTGGAANANCAGTCAGTGCCCTTAACTGCTGAGCGA
TGCATCTCTCCAGCCTGATGGTTAAGATCTTAAATAAGATTTATACCTGCTCCCTCCAATATTTGTATTGCAAACCCTAT
AGTACATATCATACATTCATTTGACAGATAAAGTAAAAACACAATTTCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97856887..97857095 203
NO GENE  

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es