Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12696A10
Clone ID IST12696A10
Vector VICTR76
Project tigm

Sequence tag IST12696A10BBF1
Sequence
GTTGCCACCTACAAACAAGTCTTAATTTTCACAAGCCTCTCCAAAGAATATAGTGATTGACACCTTTGTCACTGGAGAGA
CAGACTTGTGTTTCCCTCNNCCGTGGTTGCCCA
Sequence Type genomic DNA
Unitrap ID UNI27555

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12391136..12391247 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023827 (Agpat4) NM_026644 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene [Source:MGI Symbol;Acc:MGI:1915512]


Sequence tag IST12696A10HMF1
Sequence
GTTGCCACCTACAAACAAGTCTTANTTTTCNCANGCCTCTCCAAAGAATATAGTGATTGACACCTTTGTCNCTGGANAGA
CCNACTTGTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023827


For any suggestions or comments, please send an email to unitrap@crg.es