Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14891F6
Clone ID IST14891F6
Vector VICTR76
Project tigm

Sequence tag IST14891F6BBF1
Sequence
AAACTAGCATCGTAATTTTCCCTAAGTTAGGTCCTGGTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32263

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40222262..40222304 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]


Sequence tag IST14891F6HMF2
Sequence
AAGGGAGGGGCAGTCCAGTCCCGTGGGCTGGGAGACAGGGTGTGCCAGTCATACCCTTGTAACAGCGACTGAGGGATGCT
GGGAGAACCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95478913..95479004 92
NO GENE  

 
Come back to gene ENSMUSG00000040111


For any suggestions or comments, please send an email to unitrap@crg.es