Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M047E02
Clone ID M047E02
Vector U3betageo
Project ggtc

Sequence tag M047E02
Sequence
TAGCTCCGGCTGCTGTGGAATTTACAGCATAGCCCAGAACTCGAGGCGTCTGCTTAACCCGGCTTCTCAAATGTTGGCCT
ATAGAT
Sequence Type mRNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53947059..53947142 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 46480794..46480877 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079575 (AC158680.4) NP_001074396 SUH_MOUSE Isoform 2 of P31266 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:P31266-2]

 
Come back to gene ENSMUSG00000079575


For any suggestions or comments, please send an email to unitrap@crg.es