Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M049F05
Clone ID M049F05
Vector U3betageo
Project ggtc

Sequence tag M049F05
Sequence
CATTCGCGTACTGAGTGCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAGGCCCCCGCCTACGAGGCCAA
AACCACGATCCAATTGGGTGTCAGAACCCCGCGGAATAAGTATCCCTGGATGAACTGCGATTGACAACAGTCGGGTGAGC
ATTGGCCCAGTGTTTGGCCTGGCCCCAGCAATATCACCAGTTGTAAGGCTTATACNAGCCAAGAGGCTANNACGATACAA
TNNAANNNGATGGGAACAGTGGTCNACCATGAATAAAGGGGGGGAAG
Sequence Type mRNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180426629..180444674 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es