Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M051A02
Clone ID M051A02
Vector U3betageo
Project ggtc

Sequence tag M051A02
Sequence
TCCGCTGCGGAGGCTGCAGCGTCGGTCTGGTCCCTGCGGCTGGCGGCCGAGCCGTGTGTCTCCTCCTCCGCCGCCGCCAT
ATTGTCTGTGTGAAGCTAGGGGAGTGCGGCTATTGCCGCTCCCGCTTCCACCGCAGTGTGAAGAAAAAGGGTCTGAAACA
AAATCTTGCCAAC
Sequence Type mRNA
Unitrap ID UNI1321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152052595..152076174 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es