Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14409B5
Clone ID IST14409B5
Vector VICTR74
Project tigm

Sequence tag IST14409B5HMF1
Sequence
CCAGGGATCCTCTTGTCTCCCTTCCTCCCACTGAGATTCCAGGGAGTTACCAGTATTCCTTCCTTTGTGTGTGGGAACTG
AGGGCTTGGCATTTGTGCAGTATCCACTTTACTGATGGAGTGAGTCAGGTAGTGTTAGCATGTGGTGATAAGCTCACTAA
CTGTGGCACCTACATAGTGTCCAATGTCTGCCTGTGAAATCTCTTTAAACAGGGCAAGCTGCTGATGCTTCTGAGCAATT
ANAACGAATGGGAGGTGGGGAGGATTCTCCAAAAAGTCATTGTTTTCCCAGTGGACGTGTGAGGGCGAGTGTCTTCCCTG
TGGACTGAGGTGTGCAAGTCACTANAGTTTTANATTTGCTCTTGTGTTCCAGCCCAGCTTANTTNAAAGAACTTTANNCT
GCTCTTCTTCNTCNTCNTNNTCATCTTCTTCNTCNTCNTCNTN
Sequence Type genomic DNA
Unitrap ID UNI14281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47778852..47779290 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023984 (Usp49) NM_198421 ubiquitin specific peptidase 49 Gene [Source:MGI (curated);Acc:Usp49-001]


Sequence tag IST14409B5HMR1
Sequence
NTTTTGGGGCNNCCCTANGTCCCCATGANAAGCTNANTCTTAAAAAGCAACACAGATGGCTGATGGCTCCTGTANGATGT
CATCTGANTTTGACCTTTGGTCTTCACAAACACACACACAACCTGATTACCAAGTTCANTGCAAAATGACAGTTCTACTC
CACATCCTCTTANGATANAACATAAGGGTTAAAAAACAAAANCCCANTTACCCTGCCCGTTTCTCTGACCTTTTTANACA
AGGTCTATCTATGTACCCCAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023984


For any suggestions or comments, please send an email to unitrap@crg.es