Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10873D2
Clone ID IST10873D2
Vector VICTR76
Project tigm

Sequence tag IST10873D2HMR1
Sequence
AAAACTAAACTAAATTAAACTAAACTAAACTAAAA
Sequence Type genomic DNA
Unitrap ID UNI30782

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9089658..9089692 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039704 (Lmbrd2) NM_177178 LMBR1 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2444173]


Sequence tag IST10873D2HMF1
Sequence
CCCTGACTGTCCTGGAACTCACTTTGCAGACNNGGCTGGCCTCAAACTCANAAATCCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039704


For any suggestions or comments, please send an email to unitrap@crg.es