Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10815B10
Clone ID IST10815B10
Vector VICTR76
Project tigm

Sequence tag IST10815B10HMF1
Sequence
CATGCTTGAACCGTCTTTATTTGTGAGACAAAGGTTCACGTACCCTAGGCTGGCCTGTAAATAACTTGGA
Sequence Type genomic DNA
Unitrap ID UNI536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114439737..114439805 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]


Sequence tag IST10815B10HMR1
Sequence
TGGTTCCNGCAGTCNGAAGANAAGAGGCAGGTTGAGGCCNGCCTGGTCTACATACTGAGTCCCCAACCAGCCAGAGTTAC
ACTGTGAGACCTCTTCTCATGAAAATCAAAACCNCCACTAAAAAGCCTCTGCATCGGCTACTCGCCGAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114439804..114439954 141
NO GENE  

 
Come back to gene ENSMUSG00000079259


For any suggestions or comments, please send an email to unitrap@crg.es