Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10033C12
Clone ID IST10033C12
Vector VICTR75
Project tigm

Sequence tag IST10033C12HMR1
Sequence
AAGGTATTTAACTATTAAAAAAAAATCTGAAAATTATCCCCTAGTAATTAAAGTANAGAGCTCAAAGAATAAAGGGTAAA
GATAAGCCAGTAGGGAGGCTGTGACAGTGTGATGGCTATGAGTTCAAGATCAGTATGGGCTATAGAGAGTACAGTCAGGG
CTCCTTATATCCAGACCCTGTTATAATAACAAAACTTAAAACGAGAAAGAAAGATAAGTTAGTATGTTAGTCAATATATA
AAAAANACTTGGTGGAACAAGCCTTTAATCCCAGGACTCTGGAGGCANAGGCAGGCACATCCCTGAATCTGTCCNGCCTG
GTCTACAGAGTGAGTTCCAGGATGGC
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55005510..55005855 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]


Sequence tag IST10033C12HMF2
Sequence
CCTTCAGAAAGCTAGGAATGATCCTCAACCATAAAAGTATATTTTCATAAACGGCTTTAACAGCAGTGTCCAGTATGAGT
GATGAGAAGATCCTGACATGCCCATGGCTCCTCCTGGTTTTCTTCTACATAAGACTATTTCTACTGAGGTTCCAGGTAAC
TCCCATCCCTTAGGACAATGATTCTCAAAGACCACAGGCAGTAGCAGCTGCAGGAACTCAAACTAATTGGGATGCAAATT
CTCAGGTAATACAGAATCAACTAGTTAGGCAACATCAGAGTAAGGCCCAGTTTTAAGATCAAGTTCTGCTTTTCTCTGCA
GTAGGATGCCCTGAGACCACTCGCTAGGCTTCAAAGCAACGACATTTTTTGCTACACTGCAATCCTGCTTCAGATGCATT
TACGTTATCCCAAGTCCCTCGGGGCATAGCATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55005077..55005513 437
NO GENE  

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es