Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0344
Clone ID AY0344
Vector pGT0lxr
Project sanger

Sequence tag AY0344
Sequence
ACCAGAAACCAAACAAGAAGATCCTGATGTGGCTCGTGGGCCTCCAGAATGTGTTTTCCCACCAGCTGCCCAGAATGCCC
AAAGAGTACATCACACGGCTCGTCTTTGACCCGAAACACAAAACCCTTGCTTTAATTAAAGATGGCCGTGTCATTGGTGG
TATCTGTTTCCGGATGTTTCCATCCCAGGGATTCACAGAGATTGTTTTCTGTGCAGTAACCTCAAATGAACAAGTCAAGG
GCTATGGAACCCACCTGATGAACCATCTCAAAGAATACCACATAAAGCACGAGATCCTCAACTTCCTTCACATATGCAGA
TGAGTATGCCATCGGCNANNNCAAGTTTTTGGGGGGGTTTTTTAGAAGGGTTTTTTTTTTTTTGTTCCTTATTCTTTCTT
CAAACTTCACTCCTCAAATGTATGCAGTTGTCCTCCTCAGCGCTGCATCTGGATTTCTGAGATGGAGTTCGGTGCAGGGA
GCAGCGCCATTTTTCAG
Sequence Type mRNA
Unitrap ID UNI1902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53792444..53798747 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es