Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14555D3
Clone ID IST14555D3
Vector VICTR74
Project tigm

Sequence tag IST14555D3HMR1
Sequence
CCTGGAGTTGCAGCTAAAGGCATTTGTGCACCTCTGGACTTGGATGCTGGAAACCGAACCCAAGCTCTGTGGAAAAGCAG
CATGGGCTGCTAACCGTTAAGCCACCACTCTGGCCCCAAGGGAGTTCTTTCTTTCTTTCTTTTTTTTTTNNNCG
Sequence Type genomic DNA
Unitrap ID UNI16062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 152238043..152238191 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006010 (BC003331) NM_145511 Protein odr-4 homolog (mODR-4) [Source:UniProtKB/Swiss-Prot;Acc:Q4PJX1]


Sequence tag IST14555D3BBF1
Sequence
CAGGAAATCTGACTCCCACTTCTCAAGTCTGCACACATGTAGCTTGTTCACACAAATATACACACCAAACGATAATAAAT
CCAAAAATCTTTTGAGAAAAGAAAAGAAGGAACAAGAGTCCCAGCCAGATATGGTGGTGCAAGCCTGGAATTGCTGTACC
CTTGAGGATGAAACAGACTTGGCGCTTTGAGCTGGAGGCCAGCCAAAGCTATATAGTGAGTTCTGGGACAATCTGATCTA
AAGAGTGAAACCCTGCCTGGAAAGACACAGGAAGAAAACAAAACAACAATAACAAATATAATTACCAATTGCCATGAGAA
AGCAAAGTTACTTCTCACTCTTGGGATAAGGAAATAAGGATACCATTCAACACATCTAATTTCTTATTTTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 152238188..152238583 396
 
EST/CDNA Est Name
  CA893438.1 - CB571529.1 - CN693876.1 - CA539116.1 - BI102485.1 - BB867064.1 - CB235715.1 - CA537755.1 - CA892979.1 - AW226689.1 - AI844435.1 - CJ178175.1 - BF022705.1 - AW519396.1 - BB845190.1 - CJ172472.1 - BY134468.1 - BU699630.1 - CJ186384.1 - AA068028

 
Come back to gene CA893438.1 - CB571529.1 - CN693876.1 - CA539116.1 - BI102485.1 - BB867064.1 - CB235715.1 - CA537755.1 - CA892979.1 - AW226689.1 - AI844435.1 - CJ178175.1 - BF022705.1 - AW519396.1 - BB845190.1 - CJ172472.1 - BY134468.1 - BU699630.1 - CJ186384.1 - AA068028


For any suggestions or comments, please send an email to unitrap@crg.es