Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12308F5
Clone ID IST12308F5
Vector VICTR76
Project tigm

Sequence tag IST12308F5HMF1
Sequence
TGACAAAACAACATGACCAAAAAGCAAGTTGGGGAGAAAAGGGTTTATTTGGCTTACACTTTCATATCATTGTTCATGAC
TGAAGGGAGTCAGGACAGGAACTCAAAGGGGCAGGAACCTTGAAGCAGGAGCTGTTGTAGAGGTCGGGCCATGGAGGGGT
GCTGCTTACTGGCTTGTTCTTTATGGCCTGCTNANCCTGCTTTCTAATAAAACCCAGGACCACCAGCCCAGGGATGCACA
ACCCACAATAGTCCTACCCTGTTGTGGATTTGGTTTATTGCTTATATTATGTTAATTGGGTCCCCAAATTATACGGAAAT
TTGCCATCTGCATGTAANACACCCAGGGTCCCTGCCCCCAGTTGGTTCTAATANTTAAATAAAGGTGCNAGTGGTNNANG
NNNGNNCANGNANACANANGTGGGACTTTANATTTCCTGGGCAANGNAACNNNGGGAANAAAAANGATTTAGAATCGCNN
TGCTGATCNNGCTTGANANCTGCGGGANANGAANCATACANCNNTGNNAGANTGANANCTGTGNNNCNNGAANCNTACNG
NCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12308F5BBF1
Sequence
TGACAAAACAACATGACCAAAAAGCAAGTTGGGGAGAAAAGGGTTTATTTGGCTTACACTTTCATATCATTGTTCATGAC
TGAAGGGAGTCAGGACAGGAACTCAAAGGGGCAGGAACCTTGAAGCAGGAGCTGTTGTAGAGGTCGGGCCATGGAGGGGT
GCTGCTTACTGGCTTGTTCTTTATGGCCTGCTCAGCCTGCTTTCTAATAGAACCCAGGACCACCAGCCCAGGGATGCACA
ACCCACAATAGTCCTACCCTGTTGTGGATTTGGTTTATTGCTTATATTATGTTAATTGGGTCCCCAAATTATACGGAAAT
TTGCCATCTGCATGTAAGACACCCAGGGTCCCTGCCCCCAGTTGGTTCTAATAGTTAAATAAAGGTGCCAGTGGTCAATG
GTTGGGCAGGGAGACAGANGTGGGACTTTAGATTTCCTGGGCAANGGAACCCN
Sequence Type genomic DNA
Unitrap ID UNI33149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173875878..173876329 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015314 (Slamf6) NM_030710 SLAM family member 6 Gene [Source:MGI Symbol;Acc:MGI:1353620]

 
Come back to gene ENSMUSG00000015314


For any suggestions or comments, please send an email to unitrap@crg.es