Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14677F6
Clone ID IST14677F6
Vector VICTR74
Project tigm

Sequence tag IST14677F6HMR1
Sequence
ATACTAGACAAGAGCCCACCAGGTAACTGACTACATCCTANCCCTGATCTTATCTTTATTAGTCTCACTTGTTTANACCA
GGCTAGCCTTGAACTCAAAAATCTACCTTTCTCTGCCTCCCAAGTGCTGGAATTAAAGGTGCACACCACTGCGCCTGGCT
TCTGTTATATTTCTTGAAGTTCATAAACTTTGTACAATAAAAATACTTGAGTTTATAACAAACAGGAGTTTTC
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180441616..180441847 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


Sequence tag IST14677F6BBF1
Sequence
GTATGCGCCACGCTCTGAGTTCAGTCCCCAGCACCACAAGCACTTGGCATTCACTGTGCATAATAAGCCTGGAATCACAC
CACAAAGTANAGCAGGAGACCCTAAACTCACTGTCACTCCTGCCTACACATAAAGGTGCAGCCAGCATACACAAGGGAGA
CCTTGTCTTTCAAAAAATAAATATTCCAGGCTGGACTGGCTCATACCATTTACTCTCCTTTGANAAATGTTGGAGTTTAG
TTTTCAGCATTAATACAGAAGTGAGAGGGCTCCAAGCCACTTACAAACTCTGTTCTGGGGTTCTGACATCCTCTTCTGGT
CCCCAGACCCNNATTCNAATACNCAAAAAANAAATCTTANAANANANTTCNNAATNTTTTTTTNTNNCNNNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180441844..180442226 355
 
EST/CDNA Est Name
  CF167818.1 - AI549786.1 - AA427046.1


Sequence tag IST14677F6HMF1
Sequence
NTATGCGCCACGCTCTGAGTTCAGTCCCCAGCACCACAAGCACTTGGCATTCACTGTGCATAATAAGCCTGGAATCACAC
CACAAAGTAGAGCAGGAGACCCTAAACTCACTGTCACTCCTGCCTACACATAAAGGTGCAGCCAGCATACACAAGGGAGA
CCTTGTCTTTCAAAAAATAAATATTCCAGGCTGGACTGGCTCATACCATTTACTCTCCTTTGANAAATGTTGGAGTTTAG
TTTTCAGCATTAATACAGAAGTGAGAGGGCTCCAAGCCNCTTACAAACTCTGTTCTGGGGTTCTGACATCCTCTTCTGGT
CCCCAGACCCACATTCAAATACACAAAAAATAAATCTTAGAAAAGAATTCANNNTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180441845..180442227 373
 
EST/CDNA Est Name
  CF167818.1 - AI549786.1 - AA427046.1

 
Come back to gene CF167818.1 - AI549786.1 - AA427046.1


For any suggestions or comments, please send an email to unitrap@crg.es