Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10825H6
Clone ID IST10825H6
Vector VICTR76
Project tigm

Sequence tag IST10825H6HMF1
Sequence
TAGTGAGCACCTTGAATGTCCTTGTGACGCCAGAGCTTCTGGAGACAGGTGCAGAGTGTACAGCCTCCAACTCCCTGGGC
TCAAACACCACCACCATTGTTCTGAAGCTGGGTGAGAGCGGACTCCCTGCAGAGGCTGGCAGGGGCATGCCCAGGCACAG
GCATTAACTTGTGCTACTAACCCCCCAACTCCTTCTGCCTCCTAGTCACTTTAACCACCCTCATACCTGACTCCAGCCAA
ACCACTGGCCTCAGCACCCTCACAGTCAGTCCTCACACCAGANCCAACAGCANNNNNNCAGGTAAGCCGGGCCTGCGCAG
TGGTACCCAGTCAGTCTCCCNTTTTGAGAAAGTTAACGC

Sequence Type genomic DNA
Unitrap ID UNI33150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43948476..43948833 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032135 (Mcam) NM_023061 melanoma cell adhesion molecule Gene [Source:MGI (curated);Acc:Mcam-001]

 
Come back to gene ENSMUSG00000032135


For any suggestions or comments, please send an email to unitrap@crg.es