Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13551F7
Clone ID IST13551F7
Vector VICTR74
Project tigm

Sequence tag IST13551F7HMF2
Sequence
ACTTCCTGANGAANGAGGAGCAAANNGGAANTTAAGGAGGCNNNNCTGATCNNGAANTGNNNNNNNNNTANNCTAACCCC
NNTCATACCTATAAATGGGGGGATGGGGTGANCCCCNNNTGCNNAAANCGGTANNTTNNNTGCTNCNNGACACNTCCCNA
CNTCACCTTCNNNNNNTNTNTTATAATTACNNAANANAGTCTANNGTTAANANTCNATCNNGCNNAGTGTCTNNNCTTGA
ANNANNGTTGTGCTNTGTCCNNGATGAAAAGAGTTGANGACTGGGGGGACTGNGGCNNCCGTGANGCANANNAAAGCTCC
TTTNANGNANGAANCGTCCCGGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13551F7HMR1
Sequence
AAGTGATTTTGCTGTCAGGACTCCTTGTCAGGGAGGGAGAGGTCCTCTGGTGGTGTCTGTCCACCGAAATACACACCCTC
TCTCATCTTTTCTCTACTACTGACGATTAAACTAATTGGATAAAAATAAATCAGTAAACCTCAAGGGATTTGCTTAAGAA
TTTGACCAGCACCTTTATTCCTGCCTATGCTCTCTTGTGTGAACGTTTAGCCCCAAGGTGACTCCGTCCCTTCTGTCTTA
ATCTTAACTATAATTTTTTTCAAAGTCTTTTGTTTTGTTTTGTTTTTTTAACTTCCTGTTAAGCAGTGAGAAATAGCCAG
ACGACTTTTTTTTCAACTCCANAAAGGTTAAATGGGTCGTAAATAAACCTCACATTTAACACATTCGGTTTGGATGAAAC
ACCCAACCTTTTTTGATGACCTACTATGGTGCTTNATAGCTGGGTANGN
Sequence Type genomic DNA
Unitrap ID UNI7213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104666341..104666786 442
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070372 (Capza1) NM_009797 capping protein (actin filament) muscle Z-line, alpha 1 Gene [Source:MGI (curated);Acc:Capza1-001]


Sequence tag IST13551F7BBF1
Sequence
ACTTCCTGAGGAAGGAGGAGCAAAAGGGAAGTTAAGGAGGCCACTCTGATCAGGAAGTGACTCGTTCTAAACTAACCCCA
ATCATACCTATAAATGGGGGGATGGGGTGAGCCCCAACTGCCAAAAGCGGTAAAATAACTGCTGCCTGACACGTCCCGAC
ATCANCTTCACCTNNTNTNNTATAATTACNNAAAANANTCTAGANTTAANANTCNATCNNGCANANTGTCTCCTCTTGAA
ANAANGTTGTGCTCTGTCNNNGATGANNANANTTGANGACTGGGGGACTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000070372


For any suggestions or comments, please send an email to unitrap@crg.es