Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12656F1
Clone ID IST12656F1
Vector VICTR76
Project tigm

Sequence tag IST12656F1BBF1
Sequence
CTCTGGGGTGCATCCCAGGACCTCAGAGGCTCTAACTTAAGGAATCGGAATGCAGACTATAAATCCCAAAGCCACTTGCC
CAGTAACGTTTGCTCAGCACCTGAGATTTGGGGGATGGCCACGGAGGAATGTCCCTGCTGGCCTCTTCCCGGAACTGGAG
CCAGGGCCTGAGGCCTCACAGAACAATTGAANACTATACTTCCTGTCTTGGGGCGGAAGGCGGCTTCCCCCATCTGCAGG
GCAATGGCGGAGGCAGGGTGGGGTGAGGGGGAGAGGGAAGTCCTTGCTTCCTANCTNNNGGTGGGANGNAAGTGGTGGNG
NTNNCCN
Sequence Type genomic DNA
Unitrap ID UNI13193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31934156..31934474 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050592 (A130092J06Rik) NM_175511 RIKEN cDNA A130092J06 gene Gene [Source:MGI Symbol;Acc:MGI:2443569]


Sequence tag IST12656F1HMF1
Sequence
CTCTGGGGTGCATCCCAGGACCTCANAGGCTCTAACTTAAGGAATCGGAATGCAGACTATAAATCCCAAAGCCACTTGCC
CAGTAACGTTTGCTCAGCACCTGANATTTGGGGGATGGA
Sequence Type genomic DNA
Unitrap ID UNI13193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31934357..31934474 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050592 (A130092J06Rik) NM_175511 RIKEN cDNA A130092J06 gene Gene [Source:MGI Symbol;Acc:MGI:2443569]

 
Come back to gene ENSMUSG00000050592


For any suggestions or comments, please send an email to unitrap@crg.es