Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W095A01
Clone ID W095A01
Vector pT1betageo
Project ggtc

Sequence tag W095A01
Sequence
CCAGACCTGGACATGGCGATCAAATGGTCGAATATCTATGAAGACAATGGAGACGATGCCCCACAGAACGCCAAGAAAGC
CAGGCTTCTGCCTGAAGGGGAGGAGACAGTGGAATCA
Sequence Type mRNA
Unitrap ID UNI12401

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 145601943..145602059 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036873 (2410004B18Rik) NM_025555 RIKEN cDNA 2410004B18 gene Gene [Source:MGI Symbol;Acc:MGI:1913671]

 
Come back to gene ENSMUSG00000036873


For any suggestions or comments, please send an email to unitrap@crg.es