Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11061B9
Clone ID IST11061B9
Vector VICTR76
Project tigm

Sequence tag IST11061B9BBF1
Sequence
GTTTGACAGTGCGAACCCTTCCCTGTATTTAATGCTGTGCTTGGTATCAGAATCACTGTAGCAGGTCCCTCCACCTTTAA
AGGACTCTTGTAGGCAGGCTGCTTANATCGGCTTATCATTCCTCCCCCATATCCCCAAGATAAATTGTGTGTATCAGTTG
CATGAGTACTGCCTGGGTTATTACAGTAGTGAGCTTAAATTTTTTTTGGCCTTAGTCTATCCGCCTTTTGGTTTCCAGTA
TCTGCGGATGGGCCTANCTATTCTCTTTGTCTTTCACAGTATGAATTCTGTTTTGTCTGCAAGTGGTATATAAACCTGTG
CATGCATTTCAAGGTGTAACGGCACCTCTGTGCCTATGTCCNCCTTCNNAAATAGGATGTAGTGTGTAAGGCTANCTACG
TGGCCATTTCACCTAAGANTTTTCTNATTTTTACCATTTTTACCATAAGGAATAANGAAAATAGATAAACTTTTGTCACN
GANGAANCCATCTTCTTTCCAAGTCTGNNNCANAANNNAGNTN
Sequence Type genomic DNA
Unitrap ID UNI30536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81059191..81059696 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]


Sequence tag IST11061B9HMF1
Sequence
GTTTGACAGTGCGAACCCTTCCCTGTATTTAATGCTGTGCTTGGTATCAGAATCACTGTAGCAGGTCCCTCCACCTTTAA
AGGACTCTTGTAGGCAGGCTGCTTAGATCGGCTTATCATTCCTCCCCCATATCCCCAAGATAAATTGTGTGTATCAGTTG
CATGAGTACTGCCTGGGTTATTACAGTAGTGAGCTTAAATTTTTTTTGGCCTTAGTCTATCCGCCTTTTGGTTTCCAGTA
TCTGCGGATGGGCCTAGCTATTCTCTTTGTCTTTCACAGTATGAATTCTGTTTTGTCTGCAAGTGGTATATAAACCTGTG
CATGCATTTCAAGGTGTAACGGCACCTCTGTGCCTATGTCCACCTTCANAAATAGGATGTAGTGTGTAAGGCTAGCTACG
TGGA

Sequence Type genomic DNA
Unitrap ID UNI30536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81059191..81059593 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es