Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W052D05
Clone ID W052D05
Vector pT1ATGbetageo
Project ggtc

Sequence tag W052D05
Sequence
ACTTCGAATCTAACCAGAATTACAAGGATGTTCAGGATCCCTCAGTATTTGTAACATTCCCTGGGGAGGGGGATGGGAAT
ACATCCTTAGTTGCTTGGACAACCACTCCTTGGACTCTACCCAGTAACCTTGCACTATGCGTCAATCCAGAAATGGAGGG
GGTGAGGATCAAAGGT
Sequence Type mRNA
Unitrap ID UNI12402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49786955..49788542 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

 
Come back to gene ENSMUSG00000037851


For any suggestions or comments, please send an email to unitrap@crg.es