Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W052F04
Clone ID W052F04
Vector pT1ATGbetageo
Project ggtc

Sequence tag W052F04
Sequence
GCAAGTTCCTTTCTGTAACTCAGCGGTCATGAGAGTTTCTGTGTGATGTGTTCTGCGTGACTCTACTGGGTGTTGTGAGA
GAAGGTTAGTCAAGCTCAGAACTCCAAACATGGATTTAATCACCTATGATGACGTGCATGTGAACTTTACTCAGGAAGAA
TGGGCTTTGCTGGATCCTTCTCAGAAGAGTCTCTACAAAGGTGTGATGCTAGAGACCTATAGGAATCTCACAGCTATAG
Sequence Type mRNA
Unitrap ID UNI6524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177569225..177575053 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078863 (OTTMUSG00000016325) predicted gene, OTTMUSG00000016325 Gene [Source:MGI Symbol;Acc:MGI:3702875]

 
Come back to gene ENSMUSG00000078863


For any suggestions or comments, please send an email to unitrap@crg.es